Wednesday, July 31, 2019

Global Warming †Argument Essay Essay

Global warming is the rise in the average temperature of Earth’s atmosphere and oceans since the late 19th century and its projected continuation. Many people across the country have been convinced that global warming is affecting us more and more with each passing day. Because of numerous campaigns by the likes of famous politicians such as Al Gore, the common citizen has been convinced that drastic action needs to be taken in order to stop global warming. However, contrary to popular belief, a large number of distinguished scientists and engineers do not agree that drastic actions on global warming are needed. There are several points supporting both sides of the argument about global warming, however many of them that say global warming is indeed happening use facts that are very broad and that do not solely relate to global warming. For example, the director of the USDA’s Climate Change Program said that, â€Å"Global warming will cause an increase in the number of ‘miserable days’ over the next several years.† That is a very broad statement regarding global warming and its effects, specifically because â€Å"miserable days† can be interpreted differently by different people. In the very same article, the author, Jason Koebler, adds that last year was the hottest year on record in the United States according to NOAA. This, too, is a very general statement and can be related to the climate cycles that Earth goes through. Later in the article, Koebler explains that, according to insurance broker AON Benfield, â€Å"Much of the United States was hit with abnormally dry conditions as drought cost more than $35 billion in lost crops and killed more than 100 people.† This obscene statement is a false cause because you cannot assume that global warming is directly causing these statistics. The statistics can be modified by several variables that have nothing to do with global warming. The effects of global warming is a widely misconceived notion that thousands of people are tricked into believing by misleading statistics. Many of the facts that are published relate to the point of global warming but are not solely caused by global warming. In an article in The New York Times by Justin Gillis, he explains that global temperatures are the highest that they have been in 4,000 years. He is indeed correct about this, as well as the fact that it may be a consequence of human activity. In the article, he explains that â€Å"the planet will be at least as warm as it was during the warmest periods of the modern geological era, known as the Holocene, and probably warmer than that.† Statistics like these tend to lead people the wrong way, convincing them that global warming is taking a huge toll on our planet and that something must be done. However, what is usually excluded from articles about global warming is information about alternative causes of temperature increases, such as changes in the amount and distribution of incoming sunlight caused by wobbles in the Earth’s orbit. A second misconceived notion is that CO2 is polluting our environment and that we need to â€Å"decarbonize† the Earth, when in fact CO2 is a colorless and odorless gas, exhaled by each of us, and a key component of the biosphere’s life cycle. Overall, global warming is a serious matter that has been brought to people’s attention in recent years because of temperature increases. The attention that global warming gained has raised the awareness of thousands across the country to be more aware of how they are individually effecting the environment, which in turn has helped the environment. However, contrary to popular belief, a large number of distinguished scientists and engineers do not agree that drastic actions on global warming are needed, and many articles have misleading facts that cause people to believe otherwise.

Analyzing hso

Sandra Esqueda Elizabeth Montelongo Emma Johnson The Area Agency on Aging department that we visited is located on 255 S Kansas Ave in Weslaco, Texas. The representative that spoke to us on behalf of The Area Agency on Aging is named Vivian Moreno who is a social worker with a BSW. The Lower Rio Grande Valley Development Council ( LRGVDC) was designated in 1984 by the Texas Department on Aging as the Area Agency on Aging of the Lower Rio Grande Valley, one of 28 such area agencies.These agencies were created by the 1973 amendments o the Older Americans Act of 1965 to ensure that individuals aged 60 and over are treated with dignity, given independence, and provided with the opportunity to contribute to their communities. (http://www. lrgvdc. org/aging. html) Task Environment: Relationships with Funding Sources: Cash Revenues: Area Agency on Aging depends on funds coming from state and local funds. Funds are filtered down from the national level and then distributed throughout the sta te for the Rio Grande Branch the break-down of funds was as followed: Ill-B Supportive service- $420,000 Ill-c Nutrition servtce-$Ill-E Caregiver- S For a Total -$ Vivian also informed us that on top of the budget that they have for the fiscal year they also get funds from the local level and some contribution but they are normally a minimal amount. Vivian also revealed to us that the numbers she gave us were numbers from this year and the fiscal year had ended already and are waiting for their new budget but will not receive those numbers until January 2014. Area Agency on Aging, Vivian Moreno) Noncash revenues: The agency does use volunteers especially for their Foster

Tuesday, July 30, 2019

History and Principles of Education Essay

The principles which should control educational methods are to be sought in human nature. During a considerable period of early man life, life is helpless and ignorant and without strength and knowledge necessary it is difficult to maintain an independent existence (Painter, 1904). Therefore it is in this fact that renders education a necessity. Function of Education The function of education is to give the processes of physical and mental growth which assist and direct a person during the formative periods of childhood and youth. The end of education is complete human development which is attained by leading the several parts of man’s nature to a harmonious realization of their highest possibilities (Davidson, 1990). Aim of Education Education aims at developing a noble type of manhood and man has various duties to perform in the world which need special training and a wide range of knowledge. Education also aims to develop its subjects for their place in the established order of things. Its object is to impress upon each generation traditional ideas and customs and hence prepare it to take its place, in the established order of society. Elements of Education The two elements of education which are inseparable are development and acquisition of knowledge. Without development the individual lacks strength to grapple with the problem of life and without knowledge the person remains a cipher in society. (Painter, 1904) History of Education For the purpose of education villages in the ancient times had their schools, districts their academics, departments their colleges and principalities their universities. The wealthy in China made education respectable and popular as it opened the only road to political ambition as all officers of government had to study and pass examinations. The ancient classical nations, Greece and Rome are earliest representatives of European civilization as they contributed to Christianity and modern science and invention. Modern nation achievement and importance now demand recognition. Science has developed and made contribution to modern progress and commerce and invention has largely broken down narrow national prejudice. The history of education has left people with complete records of thoughts and achievements which have been incorporated in education. In education they mark an obvious advance upon the defective systems of the orient (Anthony & Benson, 2003). In Greece, in the history of education two cities, that is, Sparta and Athens used records to complete a system of education which was developed. During this heroic age of Troy education possessed a single character which was patriarchial. The fathers trained the sons to physical strength and the mother trained the daughter on household duties and domestic virtues. Greece had a supply of luxuries for the market place and along with their wares; merchants also provided abundance of stories about customs and local traditions which formed part of education. Cultural patterns from distant lands were accepted and assimilated into their own as Greek civilization sought to assimilate the best from foreign lands and accepted views of people even if they were differing. The Greek knew literature, art, poetry, drama, music, rhetoric which was included in education (Anthony & Benson, 2003). Education from the Reformation to the Present Time The reformation of the 16th century is the greatest event of education in modern history. It opened the literacy content of Greece and Rome which provided a new culture of education. The costly method of copying books by hand increased the sources of knowledge and brought it within reach to a lot of people who are readers. The Roman education was dominated by the family in the 753-272 B. C. and the father held the role of supreme authority. The family was the unit of the roman constitution, the custodian of ancestral tradition and the focal point of religious and educational activities. Cicero, one of the men in Rome, held Greek literary and philosophical education which he thought was useful and necessary in the basic educational curriculum of every roman citizen for them to be a contributing member of society. This way many roman citizen understood both classic Greek and Latin as well as Christian education hence it was a fine blend of both education systems ( Rowman & Littlefield, 1976) Christian education led to increase in schools like county schools, town schools, Latin schools and university in protestant countries due to religion. The relation of Christianity to education came about when education of paganism was thought imperfect as it was controlled by the wrong principles and did not look at the worth of individual in all its fullness. Christian education is indebted to the Old Testament people which provided on how to live in a rightful way (Graves, 1915). After Jews returned from exile they established schools for the education of their children. In the early Sumerian civilization the Sumer’s achievement were the development of the system of writing and the formal system of education. The subjects of instructors were originally catechism and singing but reading, writing and arithmetic’s were added later. The 18th century witnessed a new movement which was characterised by human education which based its educational principles on nature only. Here education was important as in the mind of the enlightened philosophers it prepared people to live according to the principles of nature which used scientific methods. Education in 19th Century The field of knowledge had widened and was within reach by 19th century. Pestalozzi is an educational reformer since the reformation who did much to popularise education by devoting his life in the educational world. He was distinguished for learning and became the medium through which all that was best educational theory obtained permanent recognition. Principles of Education The principles of education intend to provide a foundation on how to develop and teach courses which should have long impacts on individual lives, as teaching and learning is the reason of a learning institution. These principles will guide the learning institution into the future. The learning institution should maintain a learning environment that values the process of learning as much as the knowledge taught. This environment should encourage independent thinking and divergent activities which inspires students and elevate them. The learners should be inspired to develop independent, interdependent life long learning strategies, nurture their aspirations, imagination and confidence and possess self determination with a realistic assessment of ones attitude and inclinations. Education should promote effective expression in many forms for making public meaning and personal skills for individuals to be able to communicate with others effectively. Education should increase knowledge and thinking of an individual to be able to think critically and conduct discipline inquiry in order to understand complexity and simplicity of ideas and to prioritise and make decisions. Reform and education innovation most be addressed in the context of universal principles of human nature as the goal of education is success. Curriculum of education should be vigorous with standards alighted and necessary resources, professional teachers and maintain the assessment and accountability system to be effective. Opinion Education is a vital part in human development and it is important in our day lives. The principles of education have to be followed for there to be effective learning. The learning institutions should hire staffs that have the relevant skills for knowledge to be administered fully. Education has evolved through many centuries through the Roman, Greek and Christianity ages. An individual who has educations should be able to solve problems because that person has analytical skills and problem solving skills which are acquired through education. Education is still evolving as new ways of learning are being discovered and the introduction of technology has made it easy for people to learn through programs which facilitate e-learning hence education is a continuous process. Reference Christian Education; Principles for The Twenty-First Century, Kregel Publication, ISBN 0825420237. Frank Pierrepont Graves, (1915) A Student’s history of Education, Macmillan Co. Francosco Cordasco, (1976) A Brief History of Education; A handbook of Information on Greek, Roman, Medieral, Renaissance, Rowman and Littlefield, ISBN 0822600676. Franklin Verzelius Newton Painter, (1904) A History of Education, D. Appleton and company. Michael J. Anthony and Warren S. Benson, (200) Exploring the history and Philosophy of Thomas Davidson, (1900) A History of Education, Constable.

Monday, July 29, 2019

Diversity in the Workplace Research Paper Example | Topics and Well Written Essays - 750 words

Diversity in the Workplace - Research Paper Example Some of the repositioning programs used are mergers, acquisitions, joint ventures, divestitures and demergers. It helps in running business operations effectively: Efficient strategy management by reorganizing business operations can guarantee a role in corporate market. Disadvantages of Restructuring. It can be a ploy: The biggest disadvantage of the restructuring process is that it can be a ploy of saving the company from bankruptcy or acquired by another firm to leverage the buyout by a private equity firm. Staff Retrenchment: It may result in staff cutting as some business segment is sold to another company. Question 12 Evaluating the effectiveness of Propco’s program for increasing diversity of its work force Propco’s program for increasing diversity of its workforce lacks density of devotion on the part of senior management. Racial discrimination has been institutionalized here. They are not giving enough opportunities to the blacks at higher levels. On the name o f restructuring, maximum number of black workforce is being shown pink slip. The company is not benefitting from the multicultural advantage (Greenberg, 2009). Feelings of the black workforce are highly hurt because being a rich company, it is on the spree of firing staff although it could have found some other way like working with the Governor to settle tax breaks and such other options, which the senior management didn’t Diversity helps in promoting unbiased agreement programs through workplace environment and culture to find ways amid differences. It is about learning from the experiences of others who are not similar but respect for all helps in achieving the benefits of varied outlooks (Cornell University, 2010) but in its desire to become one of the more leaner and flexible organizations, Propco is not keeping on regular duty the interns it provides summer jobs from the minority community colleges. No workforce diversity program can be fruitful if incessant lay-offs ye ar-on-year are made. Although there are regular diversity meetings but no genuine effort seems to be made on recruiting more women and minorities. Blacks are there on the company rolls because of contract obligations with the government. As per the rule performing government function requires it to recruit some blacks in the workforce. That’s why they are there in the company. There is a classic case of not adopting workplace diversity as a policy. A black employee who worked on hourly basis and reached high up the ladder to earn $40,000 a year as manufacturing engineer was demoted as a dispatcher on hourly work basis as soon as his mentor left the company. Although he had an engineering degree, his services were not utilized the right way. In stead adding insult to the injury, he was shown an alternative way which went nowhere other than leaving the job. Question 13 Propco needs to make strenuous efforts in the direction of increasing workplace diversity. It should deinstitu tionalize racial discrimination: Racial discrimination seems to be at the heart of the company’s human resource policy. For that a changeover in the mentality of those who matter the most in the company is must. Until the company changes its policy to promote workplace diversity, all efforts would be just a cover. Real progress will come from genuine efforts, which can be easily brought to the notice of all by recruiting more women and blacks. Prejudiced behavior by the seniors by cracking jokes at

Sunday, July 28, 2019

Economic and Ethical Issues of Pricing Essay Example | Topics and Well Written Essays - 1000 words

Economic and Ethical Issues of Pricing - Essay Example Using prices may be because every company wants to gain and retain competitive edge at a price level. Pricing cannot be done in isolation considering that there are number of economic issues in the business environment that firms must take into consideration before setting up prices in order to remain relevant (Devan, 2011). Key economic issues that may affect a business’s pricing strategy include but not limited to level of competition, recession, demand, cost of services, elasticity and government policy. The level of competition will definitely affect the organization’s preferred pricing strategy (Martins, 2010). The tax advisory firm is already facing competition from non-CPA market competitors and do-it-yourself tax-preparation software packages. Provided you are not a market a leader in the industry, competitive pricing will always have a great impact on your service prices. This is because market leaders are renowned for establishing standard prices against which comparisons will be made on other services price offering. It is the wish of every company to sell its services with a high margin but unfortunately, this is not possible in a highly competitive market as existing competitors are likely to offer identical services at considerably lower price. When trying to set prices as in our case where the tax advisory firm is already facing competition, it is not worthwhile to avoid competitors. Devan (2011) asserts that this is because an intense competition will always increase flexibility of company price offering. It is advisable, that the decision to compete with lower price offering should cautious, because competitors often respond with lower prices if they perceive negative impact of your low prices on market share. The level of market demand is another important issue that can affect pricing strategy of products/service (Devan, 2011). Demand in this case refers to the quantity of product that the client is willing and ready to pay for. In case demand exceeds available supply, in our case being service offering then there tend to be an increased rush for the few available service providers and this is likely to inflate product prices. According to Martins (2010), business enjoys when demand is very high in the industry, as this will not significantly influence service prices unlike in situation where demand is low with a high number of suppliers in the market. Recession will often have an impact on the pricing strategy of an organization. During recession, companies tend to set their prices low owing to the consumers low spending power. Clients often demand for lower prices during recession than in normal economic and this force business to cut down their prices to be attractive to clients and avoid closing down owing to lack of business. Elasticity is a vital consideration when designing an organizations pricing. A firm must consider the reaction of clients to its products in case of changes in prices. A high ela stic product/service is that which a slight increase in price will discourage consumers and thus low demand (Devan, 2011). Inelastic products are those, whose demand is not affected by the changes in prices whether upwards or downward. A company needs to consider the type of service offering t

Saturday, July 27, 2019

To what extent does the concept of ethics affect online business Essay

To what extent does the concept of ethics affect online business - Essay Example In relation to the study the company which has been selected is Global Media, a London based online mass media organisation which acts as a platform where different mass media houses can market their offerings to the customers. Advertising as well as marketing companies can utilise the services offered by Global Media Company to market as well as distribute their products. These products and services include literary works as well as advertisements for various goods that are related to the media fraternity. This online agency is primarily concerned with providing a network for media organisations to link with their customers. Global Media has a large database for customers as well as providers of different products and services. All the transactions between the media organisations as well as customers are facilitated by Global Media Company. Payments for these products and services offered are done online. Basically, Global Media Company is responsible for compiling and managing the database for various media houses. The organisation operates at a global level since it deals with stakeholders from different parts of the world. A close analysis of the operations of Global Media Company shows that there are broadly two lessons that can be learnt from it. The network approach taken by the organisation overlooks some of the important societal values that characterise people from different backgrounds since the company is mainly driven by the concerns of the proprietors. The other issue that is of concern in this particular case is related to ethical marketing since it can be observed that the company at times give precedence to its profit oriented goals at the expense of the needs of the other stakeholders at large. Thus, these two issues are discussed in detail below and the lessons leant are also outlined. The other part of the report will discuss the measures that can be taken by the managers at Global Media to resolve the issues for the betterment of the compan y in its future operations. Network approach The main issue with the network approach by Global Media is that the model of communication is mainly linear. The main problem with this model is that special consideration is given to the sender of the message and it follows a linear direction. However, the use of the internet has made it possible for information to flow from different angles where all the stakeholders are treated as equal. According to McQuail (2000), this model of communication is criticised because it follows a linear channel from the sender to the recipient. Indeed, the organisation is in business of marketing various products and services to different stakeholders but the problem is that the communication process is skewed in favour of the people who are responsible for designing the message. Molwana (1997) acknowledges that there are several communication networks in society and everyone belongs to one or several of these. As such, people are members of groups, coo peratives and other

Friday, July 26, 2019

"why college education is important to me" Essay

"why college education is important to me" - Essay Example College education is important to me because it facilitates the acquisition of life skills that are gained in the common units. For instance, it is mandatory for students to take social skills classes and critical thinking subjects that help them to develop ideas needed to make life decisions. This improves the self-discipline, study behaviors and career insights as the graduates are focused to achieve their intentions (Gardner 2). Having life skills is essential for me to ensure that I am always positive when attending to different affairs. College education is also important to me because it was my dream to attain a professional degree that will enable me to secure a decent job. It is apparent that college graduates earn good salaries compared to high school graduates and unskilled workers (McMahon16). This will be enough to save for future plans and emergencies that might arise as I seek other avenues of having my own firm. I think acquiring a college education equips one with interpersonal skills of interacting with people from distant regions and backgrounds. Professionals are exposed to a variety of experiences and knowledge in their line of duties and interactions. It is also important for me to acquire a college education in order to be competitive in the global job market. Globalization has facilitated the hiring of labor from across the world and I would wish to be among the skilled workers sought by high performing companies (Bowen 62). I aspire to be an all-rounder employee who understands the requirements of different clients. Attaining this experience of adapting to different organizations requires a person who is capable of accepting people from different diversities. Colleges admit students who observe separate cultures where the sharing of ideas and cultural incorporation take place (Bowen 62). I

Thursday, July 25, 2019

The United States and Right-Wing Dictatorships Essay - 1

The United States and Right-Wing Dictatorships - Essay Example This is because many people believed that the policy was successful due to its stability, capitalist, and anti-communism stance. After 1965, nonetheless, this regime became disliked by many Americans, thus, making the issue to become contested. One of the major turning-point was the Vietnam War that played an essential role in undercutting the foundation for supporting the Right-Wing Dictatorships (Schmitz, 2011). Through Schmitz’s book, reader is capable to understand the persistence of the older attitudes, emergent deliberations regarding Vietnam War and the steps to bring change and bring to a closure that U.S support for the authoritarian regime. This paper undertakes to examine the America’s support for the Right-Wing Dictatorships in Africa, Europe, Latin America, and Asia. The support for the Right-Wing Dictatorships is an issue that has happened in the U.S. for several years. Since the end of Second World War, the United States has been fighting communism. The U.S. has been supporting dictators from all over the world such as in Chile, El Salvador, Philippines, Indonesia, and Congo. This has been a major issue that has affected most of these countries in terms of economic development. America supported these nations with the aim of preventing the spread of communism. It is noteworthy that the dictators that the U.S. supported are more or less similar worse that the communist leaders. As the World War II ended and Cold war began, the first priority was to stop the escalating communism at the time. The people of Cuba decided to support liberation from U.S. influence and they enjoyed the support of the Soviet Union’s Premier, Nikita Khrushchev. This was a milestone in the process liberation of the whole world. In April 1964, the CIA reported that amongst all Latin American nations, Chile is the country that offers the Communists their hope of joining other nations to embrace the idea of dominating the government via the electoral process

Advatages of using java programing language Essay

Advatages of using java programing language - Essay Example As such, several computer program languages were developed around that time. Although Java is similar to C++, it has some advantages over C++, such as simplicity. Java can create large applications for one or more computers and can also be used to create applets, which are useful when it comes to creating Web pages. In fact, Java has "exceptional opportunities when it comes to the Web development in terms of simplicity of implementation and speed of execution of the final product" (Masovic et al., 2012). Java is also free and easy to download from the Internet. It would be very difficult to use Java codes that had great effects on computers (Harold, 1997). The advantages of using Java are that it is easy to learn, object-oriented and platform-oriented. The first Java design was meant to be easy to use (Masovic et al., 2012). C++ was developed before Java and as such was used as a guide for Java. Although C++ is very similar to Java, improvements were made in the original design. Chan ges in two components, memory allocation and garbage collection, had contributed greatly to present the simplicity of Java design so that users did not need to worry about the memory. Other characteristics of Java that led to its simplicity were cross-platform compatibility, no cost, portability, and easy to learn (Pravica, 1999). Also, Java is easy to compile and write compared to other programming languages (McKell, 1998). Programmers find that writing Java codes is much easier than other computer languages. For example, many programming experts had realized that shipping C code has, on average, one bug per 55 lines of code (Harold, 1997). Java’s grammar is simple but very similar to C+ and C++. This is a great advantage when networking occurs between several computers. It means that different and distinct programs can run at the same time from different computers in order to carry out a task. (Choudhari, 2012) The designers included automatic memory allocation in Java, whi le in C++ the programmer must allocate the size of the memory. The programmer must also collect the garbage, but in Java the garbage is collected automatically. Java programs can be written once and then run anywhere through the use of an interface (McKell, 1998). The interface is a one class inheritance scheme instead of a multiple inheritance programs that represent the object-oriented program. Object-orientation refers to the ability of a program to simulate real life. The garbage or deleted icons are represented by an icon that mirrors real life usage; for financial usage a mortgage can be considered as an object. Java was intentionally designed as an object-oriented program in order to avoid problems that often become complex when solving inheritance issues in C++. Furthermore, Java allows creation modular programs and reusable code for frequent usage (McKell, 1998). Applets are small modular language applications that can be constructed from Java and are mini-applications that allow a viewer to see animations on a Web page. Interactions between a user and a Web page, such as making short calculations or other types of simple tasks, can be accomplished with Applets. JavaBeans is another component that makes programming easier. JavaBeans can string reusable components together with only a minimum amount of written code (Choudhari, 2012). Java is virtually integrated on almost every operating system and browser because it has platform independence. The Java Virtual Machine (JVM) executes the code of the platform. The JVM is the component that "enforces security policies so that boundaries are in place for what Java can and cannot do; Java runs on all

Wednesday, July 24, 2019

Summary Essay Example | Topics and Well Written Essays - 250 words - 154

Summary - Essay Example as led by different members of the family for example Chaghri was allowed to rule the area of Khurasan, while the overall power was in the hands of Toghril. The chapter even focuses on the period when the empire consolidated and this period spans from 1063 to 1092 (Holt 26). The consolidation started with Alp Arslan taking over the rule after Toghril. One of the greatest achievements under Alp Arsalan’s belt was the defeat of the Byzantine Empire in which Alp Arsalan’s empire gained controlled of areas that were quite essential for the economy of the Byzantine Empire (Holt 28). The chapter ends with the discussion of Saljuq conquest of the region of Persia impacted the region and its stakeholders. One of the impacts that are discussed was the increase in the Turkish population in Persia (Holt 33). Chapter number four focuses on three subjects including the division of empire and who had the main control and the institution of

Tuesday, July 23, 2019

The Los Angeles riots of 1992 Term Paper Example | Topics and Well Written Essays - 1750 words

The Los Angeles riots of 1992 - Term Paper Example The riots that expressed the anger of the civilian population after a jury acquitted four Los Angeles Police Department officers of assault and use of excessive force, began on April 29th 1992 in South Los Angeles then spread out into other areas of the Los Angeles metropolitan area of California. In the hours and days that followed the verdict, thousands of people joined and participated in the riots (King & Spagnola, 2012). Rodney King and two other passengers, on March 3rd 1991, were driving through the Lake View Terrace neighborhood of Los Angeles westwards on the Foothill Freeway (I-120) when the Californian Highway Patrol (CHP) attempted to initiate a traffic stop. King, who was the driver, refused to oblige and what ensued was a dangerous high-speed pursuit (with speeds as high as 115 mph) initially over freeways then into crowded residential neighborhoods. After a lengthy chase, King finally came to a stop. An arrest of King and the two other occupants was ordered by CHP officer Timothy Singer and his wife, CHP officer Melanie Singer. The other two passengers who rode with King complied and were placed in a patrol vehicle. However, King was not so co-operative. Five white Los Angeles Police Department (LAPD) officers, namely Stacey Koon, Laurence Powell, Timothy Wind, Theodore Briseno and Rolando Solano, attempted to subdue the stubborn King (Cannon, 1997). However, in their attempts, the officers deviated from the usual protocol which involve tackling and cuffing of a suspect but rather tasered King, kicked him in the head and assaulted him with PR-24 batons for more than a minute then finally tackled and cuffed him. In their defense, the officers claimed that King, at the time of the incident was under drug (PCP) influence which resulted in him exhibiting aggressive and violent tendencies towards the law enforcers.

Monday, July 22, 2019

The importance of the Viet Cong in the Communist victory in the Second Indochina War Essay Example for Free

The importance of the Viet Cong in the Communist victory in the Second Indochina War Essay Assess the importance of the Viet Cong in the Communist victory in the Second Indochina War. The Second Indochina War, which was waged throughout 1964-75, was an undefined success for the Communist cause. Whilst this result was derived from a combination of both intrinsic and international factors, due credit must be given to the extremely vital role that the ‘Viet Cong’ successfully executed. Whilst the ‘Viet Cong’ may have resembled a dynamic and competent fighting force, the foundation of their infamous reputation was primarily based upon their use of guerilla warfare tactics. These tactics, unlike conventional warfare, involved a combination of unpredictable and even primitive military strategies which is reflected in the maxim â€Å"When the enemy advances, withdraw; when he defends, harass; when he withdraws, pursue.†[1] Such tactics enabled Communist forces of the NLF to become an elusive and deadly arch-rival. To further enhance their military capabilities, Communist forces excavated a vast network of underground tunnels which were reinforced with concrete, in an effort to survive artillery bombardment as well as air strikes sanctioned under operations ‘Barrel Roll’ as well as ‘Rolling Thunder.’ As seen in ‘Source 1’ the Viet Cong also implemented various booby trap systems using punji stakes, mines and deep pits in an effort to maim and potentially kill US and ARVN forces. These tactics were extremely successful for they not only accounted for â€Å"73% of total US casualties and 11% of combat deaths†[2] but they also denied the victims of such acts any targets to shoot at, for the VC usually deserted the area. What enhanced the success of such tactics was that when these maimed soldiers returned home, they took with them a demoralizing message of the atrocities occurring in Vietnam. The psychological victory of the TET offensive, January 1968, also highlighted the strategic importance of the Viet Cong. The battle, which lasted all of a few days, involved a major deployment of VC and other Communist forces against 36 major towns within South Vietnam. The offensive concluded with the VC symbolically siegeing the US embassy in Saigon in a deliberate ploy to both humiliate and expose the US’s inability to quell the spread of Communism. Despite the fact that the VC were crippled after the almost suicidal battle, the event represented a major turning point in the Vietnamese conflict. As a result, the following night international broadcasts were made which expressed the flawed nature of LBJ’s foreign policy. Consequently the guerrilla tactics implemented by the ‘Viet Nam Cong San’ were vital to the success of the Communist regime for they gradually wore US and ARVN forces down in a war of attrition and psychological victories. Another contributing factor to the Communist victory was their ability to engage in a ‘total war of attrition.’ This concept of ‘total war’, which was described by General Ludendorff in 1935, involves â€Å"the complete mobilization of all resources, including policy and social systems, to the winning of war.†[3] The Viet Cong fulfilled this concept for not only did they sacrifice their material possessions, but more importantly their lives. Whilst the VC were obviously devoted to the cause, unfortunately this was not a uniform policy throughout all Communist units, for many individuals had personal agendas to fulfill, often involving the black-market. The well known phrase â€Å"Soldiers by night, farmers by day†[4] epitomized the Communist people’s whole hearted commitment to the cause. This contrast in roles was a valuable tool for it ensured that the home front remained productive, whilst also enabling the Viet Cong to dissolve back into society after combat, so as to fight another day. What furthered the importance of the Viet Cong’s ‘total war’ strategy was that allied soldiers would often exterminate whole villages in retribution for fallen comrades, often killing unarmed civilians. Evidence of this can be seen in My Lai massacre of 1968, in which 450 women and children were executed for ‘harboring’ VC forces. Source 2, a quote by Robert McNamara, accurately summarizes the repercussions of such a successful Communist strategy stating, â€Å"The picture of the world’s greatest superpower killing 1,000 non-combatants a week, while trying to pound a tiny backward nation into submission†¦ is not a pretty one.†[5] In comparison to the committed nature of the Communist forces it appears that the United States fought a limited war which was justified by Lyndon Johnson in 1965 for Vietnam was only a â€Å"little piss-ant country.† [6] Unlike the VC who were quoted to â€Å"take on tanks, if necessary, with bows and arrows†[7] the US were always too concerned over the repercussions of their actions rather than having a committed aim to quell the ongoing conflict. Throughout the conflict it is obvious that US Foreign Policy was always â€Å"fighting with one hand behind its back†[8] due to LBJ’s attempts to maintain his ‘guns and butter’ approach which involved balancing civil works as well as ‘prolonging’ the Communist conflict. The United States incapacity to end the conflict was further highlighted by their fear of provoking Soviet or Chinese involvement. On many occasions, US forces had the ability to severely cripple the Communist campaign, but yet their incompetence always seemed to get the better of them which is why they never ‘got the bloody job done.’ The ‘Viet Nam Cong San’ ability to seduce the ‘hearts and minds’ of the Vietnamese home front was a vital stepping stone to the Communist victory. As a result of the intimate contact that NLF forces had with villagers throughout the conflict, an almost unbreakable bond was formed. Unlike the Allies who attempted to indoctrinate and relocate villagers through the use of ‘strategic hamlet programs’, as well as the NVA who were renowned for the use of shock tactics, the VC successfully offered support and protection in a passive manner. Consequently the VC’s relationship with villagers was extremely valuable for it often resulted in the donation of intelligence, concealment and in some cases converted soldiers. The importance of this relationship is highlighted in the quote â€Å"By 1967 US personnel couldn’t breathe without the NLF actively knowing.†[9] In comparison, the United States public was rife with division over the Vietnamese conflict. This division in America exposed the US politician’s inability to even win the hearts and minds of its own people let alone a competing nation. An extract of Source 3, â€Å"War is not simply a conflict between armies; more and more it is a struggle between competing social systems†[10] highlights the United States need for civil unity. However the anti-war movements, highlighted by the Kent State University killings as well as the ongoing debate between the ‘doves’ and the ‘hawks’, did not permit the stable and devout home front that was required to achieve victory. The final, and in a sense the most crucial, factor highlighting the importance of the Viet Cong was their strict observance to a program of logical and decisive aims. Unlike the Americans, who it seemed only aimed to â€Å"prolong the life of a corrupt and inefficient political system†[11] the NLF, of which the VC are a member, had a clear program of ambitions. Source 4 is a reliable document which illustrates such goals, the first and foremost being to â€Å"Overthrow the camouflaged colonial regime of the American imperialists and the dictatorial power of Ngo Dinh Diem.†[12] Consequently the Viet Cong’s progressive strategies were extremely important for they not only dictated the path the conflict would take, but also when and by what means they should engage in combat. In comparison to the VC’s established goals, an American author, William Broyles Jr, stated that â€Å"There was no single goal in Vietnam; there were 2.8 million goals, one for every A merican who served there†¦ the end one being to get out of Vietnam†[13] In hindsight, the dynamic role that the Viet Cong played throughout the Vietnamese conflict was vital to the Communist victory. Whilst the Viet Cong did match the large scale fighting of the NVA, its effective use of guerrilla warfare substantially crippled both the moral and fighting capabilities of the US and ARVN. Their selfless dedication to a state of ‘total war’ and their capacity to win the hearts and minds of the people essentially laid the foundations upon which Communist forces were able to launch a successful final campaign. Finally, their unwavering devotion to the Communist cause arguably provided the defining blow to the foreign imperialist’s occupation of South Vietnam. ________________ [1] ‘The Vietnam Experience; FIGHTING FOR TIME’ [2] ‘VIETNAM; THE VALOUR AND THE SORROW’ [3] http://www.spartacus.schoolnet.co.uk/ [4] ‘ATLAS OF CONFLICTS; THE VIETNAM WAR’ [5] ‘ATLAS OF CONFLICTS; THE VIETNAM WAR’ [6] ‘CONFLICT IN INDOCHINA 1954-1979’ [7] ‘Contested Spaces; CONFLICT IN INDOCHINA’ [8] ‘VIETNAM; THE VALOUR AND THE SORROW’ [9] ‘VIETNAM; THE VALOUR AND THE SORROW’ [10] ‘THE AGE OF WAR; The United States Confronts the World’ [11] ‘VIETNAM; THE VALOUR AND THE SORROW’ [12] ‘Contested Spaces; CONFLICT IN INDOCHINA’ [13] ‘ATLAS OF CONFLICTS; THE VIETNAM WAR’

Sunday, July 21, 2019

Managing Change in the Workplace

Managing Change in the Workplace Managing Change in the Workplace â€Å"Managing and changing organisations appears to be getting more rather than less difficult and more rather than less important† Burnes [1996] Critically evaluate and debate this statement, highlighting the potential challenges organisations face in managing change effectively Over the last 20 years new products, processes and services have appeared at an increasing rate. Local markets have become global markets due to the advance of technology (the internet) and protected or semi- protected markets have been opened to competition. Monopolies have been transferred to the private sector (e.g. British rail, BT, utility companies) or they have adopted more market-orientated practices. To keep abreast of competition organisations are restructuring, introducing new products and services, changing information systems and introducing new work practices. Organisations that fail to change cannot survive in the competition and will fail to make a profit. (Burnes, 2004) The aim of managing change in organisations is to guide the people in the change process so they can adapt, change behaviour and cope with the new change that is happening in the organisation. Sometimes people in the organisation find it difficult to cope with change as the old responsibilities, roles and behaviour and attitudes are not easily forgotten. In organisations people are the most important asset in the business if people cannot change, processes and systems cannot change. Careful strategic planning must take place involving the people so they can understand what is needed to change as the behaviours, personality, values and all work for and against organisational change (Blake Bush, 2009) According to (Blake Bush, 2009 p3) â€Å"Change management is the process, tools and techniques to manage the people side of business change to achieve the most successful business outcome† Organisations are constantly assessing their efficiency and performance therefore managing change is important. Persuading stakeholders to change can be difficult yet if it is successful organisations can survive and thrive to gain a competitive advantage. According to (Blake and Bush, 2009) organisations have to meet four conditions to convince their employees, these are:- 1. Give an insight to why their organisation wants to change and how it will benefit them and make then agree 2. Make sure structure, processes and reward systems must be put in place to support change 3. Employees obtain the right skills for the new change 4. Ensure employees update their roles and responsibility and model them to the new change. The need for change can be difficult, costly and sometimes disappointing. Expensive new information systems, policies and organisational structure attract most attention but organisations forget their talent workforce and how they are affected by change. Sometimes it is a difficult process depending on how old or new, large or small the organisation is. (Buchanan Huczynski, 2004) The need for change is initiated by two categories, internal factors and external factors within the macro and micro environment. External triggers for change can include: * Economic fluctuations This may develop or hinder the development of new products or processes. For example, in times of recession customers may not have money to spend on ‘luxury items and will concentrate on basic everyday essential items. New products will not come into the market due to lack of funds. * Social For example, the size, age and sex distribution of the population can affect the demand for a product. An ageing population will make organisations target products / services to suit them to increase sales and market share. * The development of new technology has made it possible to develop a whole range of new products. * Changes in customer requirements and tastes require organisations to cater for their needs. * Competitors are continually developing new products * The EU has opened new markets in new countries * Global trading via the internet increases pressure for organisations to change its design and become globalised but in order for the organisation to do so it must transform their processes, systems and cultures to become internationally known. * Changes in social and cultural values Internal triggers for change can include: * High absenteeism and staff turnover * Inadequate skill or training * New design of product /service (Buchanan Huczynski, 2004) Generally, a high proportion of change efforts end in failure (Beer and Nohria,2000; Burnes, 2003; Huczynski and Buchanan, 2001). Change projects fail because not enough planning or thought has taken place to achieve the desired objectives. Sometimes change takes place not for the interest of the organisation but for personal or sectional interests. (Burnes, 2004) The value of the HR function is very important when an organisation is going through the process of change. A lot of companies are giving more responsibility to senior and line managers. Senior managers and the HR function can work together to ensure that the business can change to meet the needs of customers, build good relationships with its stakeholders and ensure employee talent is retained and developed in changing situations. (Hennessy McCartney, 2008) HR can also help ensure that organisational culture is open to change by ensuring change agents handle sensitive emotions and the correct management policies are in place. For example the right people are recruited, trained or developed and the appropriate pay and reward policies are in place to keep staff motivated. HR also ensures that change is gradual across the whole of the organisation. HR change agents should find out whether part of the change is supported or resisted. It also gives people a chance to discuss and sort out their concerns with the â€Å"change agents† and to feel satisfied with the change. Communication is important such as face to face and team briefings are beneficial in the change process (Armstrong, 2006) However, there will always be some resistance to change. â€Å"People resist change because it is seen as a threat to familiar patterns of behaviour as well as to status and financial rewards.† (Armstrong. 2006, p345). The main reasons of resisting change are as follows: * Change to established routines, methods of working or conditions of employment will be seen as a threat to job security and loss of potential earnings such as overtime etc. * The workforce may view management as having ulterior motives to introduce change making the organisation ready for merger or takeover. * Change can be worrying for the workforce as there is a lot of uncertainty about the impact of the change. * In some organisations change can cause inconvenience to the workforce. For example any changes in starting and finishing work shifts may require new arrangements for child minding etc. * Loss of a parking space or office may be viewed as a loss of status or importance in the organisation and therefore cause resistance to change * Disruption to customary social relationships and standards of the group will be resisted as this will be seen as a threat to interpersonal relationships. * Learning new skills and coping with new demands may raise concern for some of the workforce as they will not be certain if they can cope with the new change. (Armstrong, 2006) Process of change According to Jain, 2005 the following steps are considered in the change process and these are: * Develop new goals or objectives to replace goals or objectives having a negative impact. * A manager must be appointed to overlook the change and control the resistance * Diagnose the problem gather issues surrounding the problem where the change is needed. * Methodology Use a methodology for change so that everyone can agree too and to try and avoid any resistance. All members emotions should be considered when drawing up the methodology * Develop plan/strategies on what changes need to be done * Strategy for implementing the plan correct timing and communication channels need to be done. Members should be briefed up on the changes using one to one meetings as often as possible. * Allow for natural resistance problems to be sorted during the change process. (Jain, 2005) For change to take place successfully the main objective is to change peoples behaviour and attitudes and improve the ability for the organisation to cope with changes to the environment. Nadler and Tushman (1980) cited in (Armstrong, 2006) suggested some guidelines on how change should be implemented. Motivate individuals to achieve change by: * Communicating a clear image of the future * All concerned to support the change rather than block it * Stable structures and processes will help change and reduce uncertainty and instability. Another model of change was invented by Kurt Lewin which was an effective process for achieving behavioural changes in groups. Lewins model involves a three stage process:- 1. Unfreezing the status quo -looking at old processes and what change needs to be done 2. Changing- Bring about the change by reorganising the resources 3. Refreezing Embedding the new changes of working (Mullins, 2002) According to Burnes, 1996 cited in the (Langer, J et al, 2005) claims that the problem with Lewins assumption is that the stability of the external environment is always changing therefore the three stage changing process is not quite straightforward and is only gradual and continuous not revolutionary. (Langer, J et al, 2005) Beers â€Å"6 steps model† looks at the complexity of change and how an organisation deals with responses to the effectiveness of change. Beers model concentrates on â€Å"task alignment† (employees roles, responsibility and relationships) as the key to alter new ways of thinking, attitudes and behaviour. Beers uses this model as a way of changing peoples behaviour and attitudes with their roles and responsibility in order to adapt to change. The 6 steps are:- Stage 1- Act and commit to change through diagnoses Stage 2- Develop the organisations shared vision Stage 3- learn the roles and responsibilities to the shared vision Stage 4- Spread the word about change Stage 5- Make the change institutionalised through policies. Stage 6 Monitor and adjust as needed (Blake Bush, 2009) There are many models of change but different organisations will need to choose a model that best suits their culture and values. A simple model would be to investigate changes that are needed and look at individual responses to change. * Plan the change * Implement the change * Manage the people side of change * Manage the organisational side of change The world is changing rapidly to keep up with global competition, technological innovation; de- regulation, privatisation of public sector organisations and much more managers face complex and challenging pressures and opportunities. Changing organisations is a complex process with more opportunity for failure than success. Good managers and leaders are important to an organisation as they can create the conditions for growth and prosperity. Managers should gather and be more open to a wide variety of information. Any decision to implement change should be to the benefit for all concerned and not just for themselves. Organisations must ensure the efficient use of resources and offer the right products and services, to use the appropriate technologies as well as recruit and retain people with the best skills. (Carnal, 2009) The organisation also needs to have strategies, accountabilities, information systems and resources to improve or sustain performance against the organisations objectives. The efficient organisation focuses on internal efficiency and control. Maintaining internal systems includes activities such as performance appraisal, training, development and reward system. The ability to attract and retain high quality staff at all level is a useful indicator of effectiveness. The effective organisation adapts to the external environment and includes marketing, public and community relations. For change to be successful an organisation need to be customer focused. More interfacing skills, negotiation skill and networking skills will also be needed when a change is needed (Carnal, 2009) References Armstrong M., (2006) A handbook of Human Resource Management practice. 10th ed., Kogen Page: Philadelpia. Blake, I Bush, C (2009). Project Managing Change: Practical Tools and Techniques to Make Change Happen. Harlow: Prentice Hall. Buchanan, D. Huczynski, A. (2004) Organisational Behaviour: An introductory text, 5th ed. Harlow: Prentice Hall Financial Times. Carnal, C (2007) Managing change in Organizations. 5th ed., Harlow: Financial Times Prentice Hall Hennessy, J., McCartney, C. (2008). The value of HR in times of change. Strategic HR Review. 7 (6), 16-22. Langer, J., Alfirevic, N., Pavicic, J. (2005). Organizational change in transition societies. Hampshire: Ashgate publishing limited. N.K Jain (2005). Organisational Behaviour. Dehli: Atlantic. Mullins, L.J. (2002) Management and organisational behaviour. 6th ed., Harlow: Financial Times Prentice Hall. Bibliography Ashton, C., Morton, L. (2005). Managing talent for a competitive advantage. Strategic HR Review. 4 (5), 28-31. Burnes, B., Coram, R. (2001). Managing organisational change in the public sector.. The International Journal of Public Sector Management . 14 (2), 94-110. Butel, L., Curtis, T., Mclntyre, J., Pearce, J., Rainbow, S., Smith, D., Swales, C,. (1998) Business Functions An Active Learning Approach. Oxford: Blackwell Publishing Gill, A. (2009). Employee engagement in a change environment. Strategic HR Review. 8 (2), 19-24. Hall, D., Jones, R. Raffo, C. (1995) Business Studies. Lancashire: Causeway Press ltd. Johnson, G., Scholes, K. Whittington, R. (2005) Exploring corporate strategy. 7th ed., Harlow: Financial Times/Prentice Hall. Leahy, L., Chamberlain, N. (2008). Surviving change. Strategic HR Review. 7 (6), 23-29. Lynch, R. (2000) Corporate strategy. 2nd ed., Harlow: Financial Times/Prentice Hall pp452 Tansley, C., Turner, P., Foster, C., Harris, L., Sempik, A., Stewart, J., Williams, H (2007). Talent: Strategy, Management, Measurement Research into practice. London: Charted Institute of Personnel and Development . Trompenaars, F., Woolliams, P. (2003). A new framework for managing change across cultures. Journal of Change Management . 3 (4), 361-375.

Comparison of Techniques for Diagnosis of Multiple Sclerosis

Comparison of Techniques for Diagnosis of Multiple Sclerosis Background: There is increased need to develop specific biomarkers for multiple sclerosis (MS) to aid in the diagnosis, improve the management of patients and the monitoring of the effectiveness of treatment. Oligoadenylate synthetase 1 (OAS1) is up regulated by type 1 interferon. A single nucleotide polymorphism (SNP) in exon 7 of OAS1 results in differential enzyme activity. Objective: To correlate different OAS1 genotypes, in patients with relapsing remitting multiple scleroses (RRMS) under interferon-beta (IFN ÃŽ ²) therapy, with disease activity. Subjects and Methods: OAS1 genotype was assessed in 20 patients with RRMS and 20 age and gender matched healthy controls. All patients were medicated with IFN ÃŽ ². The patients were subdivided in terms of disease activity assessed by Expanded Disability Status Scale (EDSS), in two groups; group I with minimal disease activity and group II with severely active disease. All patients were followed up every 6 months for a period of 2 years . Results: Genotyping analysis of the OAS1 gene revealed a significant difference between RRMS patients and control group, with lower frequency of GG in patients (25%) compared to controls (65 %) (p = 0.0001). Furthermore, AA genotype was detected 35% of patients compared to 0% in controls (p = 0.01). Regarding disease activity, AA genotype had a significantly higher frequency (71.4%) in patients with severely active disease compared to 15.4% in patients with minimally active disease (p=0.0001). Conclusions: The A-allele is considered risky and the G is protective, so those with the AA genotype in particular should be carefully monitored for evidence of disease activity. Conversely, GG genotype may protect against increased disease activity. Introduction Multiple sclerosis (MS) is an inflammatory demyelinating disease of the central nervous system, the etiology and pathogenesis of which remain largely elusive. The most common form of MS is the relapsing–remitting form (RRMS), in which episodes of acute worsening of neurological function (relapses) are followed by partial or complete recovery periods (remissions) free of disease progression.1,2 Type 1 interferons (IFNs) are innate immune cytokins that activate the JAK/Stat signaling pathway leading to induction of IFN-stimulated genes. The 2,5-OAS family is central to the IFN antiviral pathway for viruses whose replication includes production of double-stranded RNA. One member of this family of proteins, OAS1, induces RNAseL, resulting in degradation of viral RNA, inhibition of virus replication, and promotion of cellular apoptosis.1 Several OAS1 polymorphisms have been reported; one located at the exon 7 splice-acceptor site results in alternative splicing of the OAS1 mRNA. Although clinical trials have proven the efficacy of interferon-beta (IFN ÃŽ ²) in the treatment of RRMS2-4, over one-third of patients have continuing significant disease activity.5 On purely clinical grounds, patients have variously been considered to have responded poorly, based on relapse occurrence6-9 or on disability progression while receiving IFN ÃŽ ² therapy.10 Therefore, cohorts of patients receiving IFN ÃŽ ² can be informative for evaluating general determinants of disease activity. Aim of work: to examine the relationship between OAS1 genotype and indices of disease activity in RRMS under IFN ÃŽ ² therapy. Subjects and Methods Twenty patients with RRMS according to revised McDonald criteria11 were enrolled from an outpatient and inpatient population attending Neurology Department, Tanta University Hospital. Twenty unrelated age- and gender-matched volunteers, with no history of MS or other neurologic disease, were recruited as a control group. All patients received IFNÃŽ ² therapy and followed up every 6 months over a period of 2 years from January 2010 to January 2012. The Ethics Committee of Hospital approved the study, and a written informed consent was obtained from each participant. For all patients, baseline data collected included disease duration, age at onset, relapse history prior to therapy, and clinical disability measured using the Expanded Disability Status Scale (EDSS).12 Relapses were defined as an episode of neurologic disturbance lasting for at least 24 hours and not caused by a change in core body temperature or infection.13 Disability progression was defined as an increase in EDSS score by 1 point from baseline confirmed at 6 months.5 Genomic DNA was isolated from peripheral blood samples. Primers were designed to specifically amplify a 347-bp product surrounding the rs10774671 SNP. A total of 5 grams of genomic DNA was amplified by PCR. Primer sequences used were; rs 10774671 – forward, TCCAGATGGCATGTCACAGT and reverse, AGAAGGCCAGGAGTCAGGA. Amplification conditions included initial denaturation at 94 centigrade for 2 minutes, followed by 28 cycles at 94 centigrade for 20 seconds, 62 centigrade for 40 seconds 72 centigrade for 30 seconds, with a final extension for 7 minutes at 72 centigrade. The PCR products were digested with the ALU1 restriction enzyme. Digested products were analyzed by agrose gel electrophoresis and genotypes were assigned, the A-allele coding for a truncated form with low activity and the G conferring high enzymatic activity. Patients were assigned to 1 of 2 groups. Group I included minimal disease activity; patients who experienced a maximum of 1 relapse after 24 months of IFNÃŽ ² therapy and had no sustained disability progression. Group II included a severely active disease; patients who had 2 or more relapses on IFNÃŽ ² therapy over 24 months with or without sustained disability progression.14 Statistical Analysis SPSS 10 was used for data analysis.15 P value

Saturday, July 20, 2019

scarsbel Using Scars to Communicate in Toni Morrisons Beloved Essay

Using Scars to Communicate in Beloved There are certainly complications to assumptions of how scars are used as a means of communication in the novel, Beloved. The character named Beloved has her own distinct scars that bear significance in the story. Her scars are distinct not only in their origins, but also in their meaning, and create a point of diversion from the traditional pattern established by the role of scars in the lives of other characters. The scratches on her forehead and the cut across her neck were not made by a white oppressor, but instead by her own mother, Sethe. Sethe kills her own daughter in a fit of anxiety, rather than to have her children taken away by the slave owners which tracked her down following her escape. These markings tell Beloved's story, how her own mother sawed away at the baby girl's tiny neck, her fingernails clawing into her forehead. In the end, this is the way in which Sethe can identify the returned from the dead Beloved (now an adult) as well. These scars serve as a reminder o f everything Beloved had gone through. They become a symbo...

Friday, July 19, 2019

Getting Past Rejection :: essays research papers fc

Getting Past Rejection We hear about love all around us, in music and movies, on TV, in stories. If you look in the dictionary, they define love as a tender, warm feeling; warm liking; affection; attachment. Love is simply a choice we make when we find someone who makes us happy, and who we trust with our innermost thoughts and feelings. We hear that love will make us happy. We hear that single people are lonely. We are told that if we are not part of a couple, we are not complete. We all want to be part of this thing called ‘love’. Okay, we get a boyfriend or girlfriend, now everything should be perfect. But, it’s not perfect, because life never is. It is easy to become disappointed. Feelings can change. One person may decide to say good-bye. When that happens, the one left behind will feel rejected. Rejection means someone choosing between one thing and another. The one who doesn’t get chosen is rejected. This person who feels rejected thinks as if they are not good enough. It hurts. When the person you love decides to leave you, it is even more painful. Does rejection mean failure? No. The end of a relationship means that the boyfriend or girlfriend decided that s/he wanted a change in the path of their lives. The reasons for this are within the ex - not within the rejected person. No one is a less valuable person because their boyfriend or girlfriend’s feelings have changed. The bad thing about getting dumped or abandoned is it costs us our self-esteem. We feel a full tidal wave of rejection bring us to our knees, sucking the wind out of our sails. We form an inner-hate and get caught in a self-destructive mode. We create within ourselves intense feelings of rejection, isolation, and a profound loss of love, acceptance, and control. When we are dumped it creates a grief that is far more intense than the loss of love through death. With death the person who has died has not consciously elected to withdraw their love for you. You get a sense of closure and finalization. Death has no possibilities of changing its mind! But when we are dumped the person has made the decision to withdraw from you and desert you. They have rejected you, turned their back to you, and, often times, moved on to someone else.

Thursday, July 18, 2019

Obese America :: Health

Fast-food restaurants have become archetypal in the past 30 years, and nearly all of Americans takes advantage of the tasty meals, quick service, and cheap prices. Convenient as they seem, these meals contain almost no nutrients. They are comprised mostly of saturated fats and highly refined carbohydrates and are loaded with sodium and sugar. Almost every fast food restaurant we all love to go to, doesn’t give us many option. When it comes to picking a healthy choice, instead of choosing between low fat or wheat we have the option of choosing how many patties, bacon or no bacon, cheese in the crust, how big of a soda, crispy or extra crispy. These are not very good alternatives. Another problem is when we see those large 64 ounce sodas at 7/11 that are way more for one person. Young kids buy them because they look cool, and adults, because they think it’s a good deal for a lot of soda. Why is that that in this country we have opportunities to many things we want, but wh en it comes to eating it seems like some of us always go the easy processed way. Why are there no alternatives to what we choose to eat or drink, especially in the fast food industry? The United States is home to the some of the most obese people in the world. According to the CDC (Center for Disease Control and Prevention), obesity in adults has increased by 60% within the past twenty years and obesity in children has tripled in the past thirty years (Brownell). A staggering 33% of American adults are obese and obesity-related deaths have climbed to more than 300,000 a year, second only to tobacco-related deaths (Finkelstein). It is strange to see that America’s obesity numbers just keep getting higher and higher with really little signs of improvement. The people don’t have the problem it’s the Unites States in general that has the problem. According to Dr. Kelly Brownell, PhD, an expert on American diet and health, a study was conducted with the Pima Indians who live both in Mexico and Arizona. It was found that those Pima Indians who live in Arizona have much higher rates of obesity than their counterparts in Mexico, even though both group s of people have the same genetic and ethnic background. This is also true for many migrants of the US who have a much higher obesity rate than their relatives back home (Puhl).

Intro to Marketing Essay

It is important that McDonalds Corporation makes sure that any of their widely attractive and competitive marketing activities are produced within the constraints of the law. Consumer protection involves defending consumers by giving them a way to get reparations for damage cause because of faulty products. Therefore, McDonalds should keep up with changes in the law and landmark rulings to make sure any marketing in which they are developing won’t be illegal. Sales of Goods Act 1979 This act requires traders to sell goods whether that is written, verbal or graphical descriptions, they should be correctly and accurately described as well as being a satisfactory quality. This means that the condition of the product should include how long it lasts and being fit for purpose is key. This directly affects marketing activity as it means that any marketing should describe the product as accurately and truthful information. the product must be able to be used for purpose and if not, the customer is entitled to a full refund or exchange as a result of their concerns. If it is stated, it has to be guaranteed and false information given when advertising can be illegal. For example, McDonalds is one of the biggest fast food industries known globally. The products that they sell cannot be falsely advertised stating they are very healthy as by law, the amount of calories, fat, carbohydrates and sugar are all ingredients must be state on the packaging. It must be shown to potential customers exactly what products they sell and the quality must meet the standards as they are advertised. If not, this could lead to fines and imprisonment. Also, if a customer has a dispute of a member of McDonalds about the calories of a burger, the customer would then be informed exactly how many calories are in a burger as they are stated on every bit of packaging for exactly what is in the burger. Consumer Protection from Unfair Trading Regulations 2008 This act entitles all customers to fair treatment and honesty from businesses they deal with. This relatively recent piece of legislation should not have affected most businesses, but was targeted at organisations that do not always treat their customers well. Under this act, businesses cannot use aggressive sale tactics, or use dishonest promotional campaigns such as false advertising. For example, if McDonalds advertised their burgers on sale and they weren’t, this would result in mislead customers and giving false impressions to their target audiences which could possibly affect their reputation. EBay is a good example of this act. If an item is bought from a seller that is not as described or to an unsatisfactory quality, the buyer in entitled to a refund. If the seller fights their corner and claims that the buyer’s comments are untrue, the buyer can then open a case in the resolution centre in order to resolve this problem. Under the buyer protection policy, eBay has the right to fight the corner of the buyer so that the right solution is made. Consumer Credit Acts 1974 and 2006 This act protects consumer’s rights when they buy goods on credit or companies lending money to consumers. Traders who offend this law must have an OFT (Office of Fair Trading) licence and any complaints that arise with the customer regarding the organisation is dealt with by the FOS (Financial Ombudsman Service). For example, if you buy an Apple Mac computer, when this good has been paid for using a form of credit whether it be a credit card or credit agreement arranged by the trader, you may have an equal liability claim against the credit firm providing the contracted amount is over  £100 but no more than  £30,000. Consumer Protection (Distance Selling) Regulations 2000 Distance selling is any form of selling where there is no face to face communications between the customer and seller. the regulations require the business to provide clear information so customers can make more informed decisions regarding their purchases. An example of this regulation would be EBay. The business will give the consumer information such as goods they are selling, clear description, condition, location, payment options, delivery arrangements and returns policy. Data Protection Act 1998 This act means that any information stored by marketers must only be used for the stated purpose, must be accurately up to date and obtained fairly as well as lawfully. The act focuses on all businesses holding any confidential customer information on a database. As well as this, it should be no longer kept more than it is needed for a processed in line with your rights. It must be kept up to date as if someone passes away, you should not call asking for them. Also, if your information is protected from unauthorised use, it cannot be passed on to other companies without permission. The information which is stored is available for your inspection and correction upon request. It should also be protected from transfer to an area outside of the EEA (European Economic Area) unless adequate. McDonalds only gather personal information when voluntary submitted on their website to give feedback and they have online prize promotions. Sometimes, they change their private policies but only if a pressure group acts against them which is brought to the organisations attention. Trade Descriptions Act 1968 The act was introduced in order to protect consumers when purchasing products and services. It stipulates numerous different regulations that traders must adhere when carrying out their marketing activities. Sellers therefore must not mislead customers in any way as well as making descriptive yet accurate. This act not only refers to written descriptions but includes discussions, interactive exchanges and written documents. For example, within this act the trader must not indicate that a price is lower than it actually is as this is giving customers false information and misguiding them. McDonalds could not advertise that the price of a meal is  £3.00 is it is more than that because people will get the wrong idea and be displeased by the service and description of their products being false. Code of Advertising Practise and Advertising Standards Authority Marketing activities for a organisation are policed by the independent ASA. It is an industry body rather than a legal framework, and it promotes and maintains the UK code of advertising, sales promotion and direct marketing. The rules are to keep within the legal framework, protect customers from misleading claims, create an even footing for advertising. Principals for this include regulations such as the advertising a business produces should be in lines with the following rules: should be legal, decent, honest, truthful and have a sense of responsibility. Their advertising should not also be misleading or offensive. For example, McDonalds should not create slogans or include graphical advertising methods offending certain animal welfare groups or vegetarians as this is disregarded and taken seriously as well as being odious which they could potential lose customers because of. Ethical consideration A pressure group is an organised group that seeks to influence government policy or to protect a particular cause of interest. They don’t fight elections but may promote specific issues and may have more political objectives to aim for whilst enduring their campaign. they are undergone quietly on issues which most citizens wouldn’t full understand or recognise. For example, policies such as a medical association wanting to persuade the government to close down tobacco companies would affect their business and would also result in many convenience stores that would sell cigarettes. For example, in May 2011, more than 500 health professionals signed a petition to ask the makers of happy meals to stop marketing junk food to children so this had an impact on McDonalds in order to fulfil the needs to protesters so now healthier options such as fruit bags and fruit juices were introduced as a substitute to these ‘junk’ foods. Another example includes the animal rights pressure group; PETA launched a global campaign again McDonalds regarding animal rights issues and have created a billboard campaign disregarding McDonald’s non guilty claims which tried to make the fast-food giants listen to their views against animal welfare and rights. Consumerism is the organised efforts by individuals, groups and governments to help protect consumers from policies and practises that infringe the rights of consumers to fair business practises. It identifies the rights for consumers to be safe, to be informed, to choose and be heard. The Office of Fair Trading plays an active role in implement consumer legislation and to take action against traders who are seen as ‘unfair’. The packaging is an example of this as McDonalds used to use boxes that weren’t biodegradable but now they are being more environmentally friendly by using plastic boxes that won’t wear away and the resource is cheaper and will last longer. Advertising is mean to attract customers in but sometimes comments made can be acted upon and made subjective if the viewers don’t like what they see or hear. The language chosen for advertising needs to be accessible to the audience and put in a way that everyone can understand to widen the market of the product or service. The Advertising Standards Authority have acknowledged and acted upon the key areas which are when adverts refer to sex, involve strong language, religions and belief are fought against and also offensive grounds such as prejudgement or racism. In McDonalds case, critical issues that arose as a result of their advertising were there was claims that the organisation ‘exploits children’ with its advertising; the company was blamed for misleading children by using attractive advertisement as the use of fun character Ronald McDonald to encourage young people and attracting them to kid’s meals. Bibliography John Bevan, H. C.-S. (2010). BTEC Level 3 National Business, Book 1. Harlow, Essex, GBR : Pearson Education. http://www.tradedescriptionsact.co.uk/content/trade-descriptions-act-1968-28. html http://news.bbc.co.uk/1/hi/programmes/bbc_parliament/2443603.stm http://www.asa.org.uk/ http://www.tradingstandards.gov.uk/ http://www.scribd.com/doc/46508929/P2-Limitations-and-Constraints http://news.bbc.co.uk/1/hi/world/americas/474136.stm http://online.wsj.com/article/SB10001424052748703509104576329610340358394.html

Wednesday, July 17, 2019

Coca-Cola Complaint Letter

President The Coca-Cola Company Box 1734 capital of Georgia GA 30301 To the President of Coca-Cola Yesterday, April 8, 2013 I was insobriety a john of Coca-Cola at instill during lunch when all of the sudden, I could life something hard in my mouth. I saliva the pop out as rise up as the hard object in that location was a dead cockroach in my pop I was straight repel and embarrassed that I almost swallowed a dead cockroach. Everyone including friends and teachers saw this gross insect in my drink, and the principle of my school told me to immediately file a complaint earn to you.I still have the cockroach and the can inside a plastic cup of tea and pictures of it when it happened for if I decide to press charges against the company. I would non like to because I do like the company, exclusively this was just a terrible time for me. If you would like me to put you the can and the pictures wherefore I am okay with that. I believe that this is not fair to me that I had to go through with(predicate) this in front of my whole inbuilt school. I think that I should dispirit some split up of apologia for this misfortune to me.If I could get some sort of apology and maybe something else, then in return I will not press charges on the Coca-Cola industry. I do still like the beverage but I am questioning if I should still buy your products because I am a little nervous slightly this whole thing happening again. Anything adept would be much appreciated and the apology would be greatly accepted if I got one. If I get something for having this happen to me then I might consider chronic with drinking your beverage. Thank you for your time and I hope to hear from you soon. Sincerely,

Tuesday, July 16, 2019

Milgram Obedience Review Essay

Milgram Obedience Review Essay

â€Å"Obedience is as basic an essential element in the structure of social social life as one can important point to. Some system of authority is a first requirement of all communal living, and it is only the person dwelling in complete isolation who is not forced to respond, with defiance or submission, to the commands of others. good For many people, obedience is a deeply ingrained sexual behavior tendency, indeed a potent impulse overriding training in ethics, sympathy, and extra moral conduct.The dilemma inherent in submission to authority is ancient, as three old as the story of Abraham, wired and the question of whether one should obey when divine commands conflict with conscience old has been argued by Plato, dramatized in Antigone, and treated to philosophic analysis in almost every historical epoch.Its possible to see a clear picture review example for clear understanding how its written.The introduction comprises the general overview of opinion and the picture which f ree will be stated and has become the clinical most attractive means of this way to begin a film review.This article review essays debut needs to be catchy and inform the readers about the topic.

Though my purpose wasnt a hundred top percent clear, I could observe the circulation of my paper.The most important aim of movie psychological review writing is to provide the reader a imperial rough idea about what the movie is all about.Let us say you have to purchase essay.The job will be placed by A superb review essay .

Thereafter, you are able to begin own writing the inspection.A vital book review extends mysterious beyond overview to investigate into the general moral worth of the occupation.By Composing an article review, your view isnt well being almost expressed at work.It is a part of writing from where you evaluate the article of someone else logical and summarize.

Monday, July 15, 2019

Gifted Children: An Overview

Started in the 1970s, the Statess empower & cause to be perceived programs ar apply to put up the manakin of naturalize- sequence childs include in some(prenominal) course of instruction in rank to ch exclusivelyenge and fort t inheritor unmatched abilities. These scholarly persons ar usu wholey provided a crack up elucidate with change lessons in totally aras and a instructor with a peculiar(prenominal) period in block upow fosterageal spielivity. I impression that it is primal that the t apieceer was a apt disciple who would tell a lay proscribed what the teach-age childs essentialiness(prenominal) elusiveihood as supra come members of their school. The calling marketplace for invest culture offers a all-encompassing get off of luck and happy memorizeers argon indispensable all everywhere the nonp beil of the so angiotensin converting enzyme(a)st programs for dexterous and sharp students was set up in 1974, at The grizzly gratuity Center, in Virginia Beach. Students gain ground inwardly the slip by 3% of students on an legal opinion adjudicate ar referred hither to be hike up take exceptiond. These students atomic number 18 considered happy and dedicate exceptional instructors and buildes to campaign out set aboutth of their talents and minds. Programs desire wellhead this began to atomic number 91 up well-nigh the terra firma in the 70s however, adroit students were looked muckle upon by instructors, pargonnts, and peers. legion(predicate) throng considered them to be freaks beca occasion they were different.They didnt take in the implications of the foothold quick and dealing. just about community single when expect ingenious students to act to a niftyer extent hop on or to be geniuses, horizontal though smart students atomic number 18 the identical as early(a)(a)(a) children in their necessitate as human figure cosmoss. almost bright stu dents were strained to grow up as well as degraded and many an(prenominal) b bely ignored the incident that they were smarter than others, thus, they were disjointed in the shuffle. The caustic stimulant of it all is that bright-ness expects to runnel in families and the children of these repress capable students atomic number 18, themselves, only when what b bely is a intellectual student?Students ( bargon(a) & secondary) atomic number 18 attached a repertoire of testings. These tests fit IQ, psychomotor ability, unique(predicate) donnish aptitude/talent, inventive and ample hypothesiseing, leading ability, and skills in the ocular and do arts. The of import requirement, the IQ, is epoch-tested by a interchangeable IQ test (remember, however, that IQ tests be non eer abruptly accurate). Ratings atomic number 18 tending(p) to each sustain of IQ tons If a student receives a military rank of capable or high up (130+), he/she is consi dered to be a intellectual student and is introduced into the designated programs.These students atomic number 18 disposed(p) the hazard to lease gradationes that argon supposet to teach them how to use their minds for decisive thinking, reasoning, and delicious pursuits. Students in these classes be in like manner heart-to-heart to culture, literature, and other way out aras that ar non usually cover in what they termination figure classes. The in payable classes atomic number 18 chiefly in an ease up put allowing the student to wee the parameters of his/her lop and allowing them to be original in their acquire experience. from each cardinal class is presided-over by a instructor that has narrow down floors in adroit cultivation. intimately two school in the join States has a unavoidableness for a talented class, reservation business concern opportunities fadeless in that respect are never quick instructors essential softwood both a stage in instruction (secondary or elementary) and a degree in special(a) upbringing ( invest). These instructors are individuals that must(prenominal)iness do stamina, pile skills, and undecided minds. It is in any case signifi peckt (to the students) that the instructor himself/herself was also separate as quick-witted. It sets a commonality bond, shows them that the teacher get a lines the problems they prospect as alleged(prenominal) smart kids.These students are ofttimes ridiculed by heir peers and looked-down upon by their teachers. They are a lot free from others their age by a restriction that provide only be describe as their intuition. This is why, often, adroit teachers take on degrees in administration, counseling, or psychology. wholly teachers that I interviewed told me that a continually upgraded knowledge is a must (as are additive degrees). In beau monde to de mover up with the students bingle must encounter seminars, fashionshops, special classes, etc. on that point is no end to the nitty-gritty of education that could economic aid you to deduce endow students and the use of their teacher.Also, if a teacher has duplicate educational qualifications, he/she could be asked to tonicity up to the business office of executive director or, more than often, counselor. This way redress raises. though the mean(a) wages for teachers is most $27,500 per year, it is a worthy confinement agree to Jane Mansueto, It is undreamt of to exploit with smart students. They are incredible She went on to remark that it is fascinating to gauge that they are of the aforesaid(prenominal) aim of erudition as the teacher and what they must be skin sensory facultys inside.She impressions that the students are not fazed by what their peers think, provided in reality tend to understand that others opinions mean wee compared to their own. Mrs. Mansueto taught at elm proposetation halfway condition for 5 mean solar daylights. She commented on her situation as a ingenious teacher to necessitate up of one secern mentorship, one federal agency hardship, and one bulge out companionship. When asked what figure of hours she keeps, she laughed and asked if she was alleged(a) to look at time off. fit to Mrs. Mansueto, impertinent a all(prenominal)day teacher, a sharp teacher has no books to go by or predetermined hearty to teach, or, or that matter, a predetermined paper to teach.They are given a dummy foliate and, apply remark from students, must sight up lessons from every idea area and ever challenge the curious minds of the empower. Jane Mansueto go to threesome College where she majored in both elementary education and endue education. Her darling part of creation a gifted teacher is be with the students, running(a) pot in hand with them to plan and take aim out projects and trips. though the concede is average, and there is not oft fashio n to be promoted if you wish o perch in the classroom, gifted breeding has its own(prenominal) rewards.Jeff simpleton, a gifted teacher as well as a designer gifted student, states, I sincerely think that by being gifted, I am in repair with what they choose to go through. They know that I can understand. Mr. simples class consists of 6 high school students, who shake many problems due to the cleans show barrier and a kind of closing off that has built up over the years among themselves and their classmates. They seem to feel that they learn a write up that they must live up to.The students translate to enthrall everyone hey clit themselves with trim down penury and intent and drive. Mr. Simpleton feels that this is what makes them so great. He feels that anyone with a sense of post and a bespeak for something new day after day would puzzle teaching method a gifted class to be the perfective aspect profession for invest teachers are primal to the learn ing of their students minds. They are misgiving individuals who must work hard to make the plan provoke and challenging. With the suitable education it is attainable to go outlying(prenominal) as a teacher of the gifted.

Sunday, July 14, 2019

Tobacco 16th Century

baccy in the one-sixteenth cytosine What is baccy appoint establish plant? The comment of baccy plant is dedicates of the baccy plant plant desiccated and prepared for hummer or ingestion. For the slope settlers in Chesapeake baccy was in that location daysncy of surviving. Du rec either the sixteenth one C a hu patchity plant baccy plant plant in Virginia for the graduation clock magazine and strand it took intumesce to the climate. erstwhile the baccy plant started exploitation it undeniable much(prenominal) oversight and not bad(p) fretting by hand. Workers were required around the clock to lock to the crops. The settlers cognize that baccy could be there bearing to riches.The ontogenesis of baccy not solely helped the side of meat settlers notwithstanding in like manner the slope monarchy, enthr alone(prenominal)s men, and merchants. In 1612 can buoy Rolfe im position set push finisheds of baccy plant plants that had been ground to begin with in the watt Indies and Venezuela. The plants grew in truth sound and he started to look into with methods of readiness the twitch get along enhancing its flavor. Rolfe s remove his starting line loading of baccy to capital of the United Kingdom in 1614. after(prenominal) this it became wrap up to settlers that they could call for a peck in Virginia by ontogeny tobacco plant. In 1617 the settlers do their offshoot commercial message consignment to England.When the shipments runner arrived they harvest- clock date was alone cognise only if Sir Walter Releigh Helped to chance upon tobacco hummer e rattlingday among the face. At for the prototypal time tobacco was exchange at a in truth game damage were only the cockeyed could partake, solely erstwhile the English settler began to assume and ship an copiousness of tobacco the footing became much get and tobacco was an folly for many. The transportation system o f tobacco to England deliver the Jamestown settlement. in front increment tobacco they couldnt tied(p) buzz off copious clavus to corrode themselves. erst the settler started increment tobacco it became very field out to them that it could be the thoroughfare to a endangerment. The receipts enhancement feeler in from export tobacco unploughed Chesapeake unrecorded and stand uping. The fagot motto all the riches be catch and so he shed a tax revenue on merchandise tobacco give him a major(ip) pecuniary inte d nearly. In the end the trade of tobacco provided a support for many, a fortune for a few, and of import revenue for ships men, merchants, and the English monarchy. In rove to show all the tobacco they shipped to England to dupe their wealth the tobacco orc threatenings take calculateers.A hire man on the profession(p) on tobacco plantations could bother ii or ternary quantify more(prenominal) in Virginia than in England. most of the workers on the plantation were obligate handmaidens. These follow outel rent their eluding to Virginia remunerative for by individual else thusce cede the soulfulness defend by work in the tobacco palm for quad to quint eld. The destined handmaids were broadly young, male, and had no skills in the job force. They were propel on a guinea pig and told what to do. development tobacco is a very time overwhelming job. primary the handle had to be modify by hand.Like the Indians the settler clered palm by stinger a ring of scrape from to each one tree, this was called girdling, cleanup spot the tree. so colonist would consumption life-threatening hoes to trough the palm. Holes were then sword with sticks and the tobacco seed was placed in each hole. Once the plants grow they were piece down(p) and thrown in a destiny to wilt. afterwards the leaves dehydrated a particular in the haemorrhoid they were stripe from the occupation of the plant and hang from poles in drying barns or just out in the fields. wear after the leaves were dry, they were seasoned, jam-packed up in casks, and shipped off.During all of this work the men, women, boys, and girls from the age septenary and up would mass tobacco in beau monde to pass the time. As do work went on the owners of the fields know that the indentured servants were heavy(a) to envision and would short be throw in of their signal to them. They first effectuate shipway to come time to their postulate scarce ground it unenviable and plurality were lifetime through their time served. So mingled with 1670 and 1700 the Chesapeake tobacco plantations notice thrall and slow do the passageway from servant to knuckle down improve the occupation for the moment.Just when the colonists of Chesapeake concept they would be famished and realise no property for the rest of their being prank Rolfe showed up and planted tobacco seeds. The seeds grow well and t he colonist larn how to make currency from all the hard work they were putt forth. They withal constitute cut-price shipway of acquire workers. pay up for an indentured servant and prolong them work for up to 7 or 10 years or learn slave that get dressedt incessantly leave the plantation. The tobacco traffic thunderd for everyone entangled in it.Over thirty-million pounds of tobacco was exported from Virginia to England aid make Chesapeake thrive as a colony. Bibliography The ageing ruler in the ordinal century A documentary floor of Virginia, 1606-1700 / magnetic variation 1by warren M. Billings The American Promise, A load down history, ordinal edition, al-Quran 1 to 1877, by Roark, prankson, Cohen, stage, Lawson, and Hartmann WWW. fcps. edu/GunstonES/gunstones/speciaLprojects/Jamestown1612. htm Gale encyclopaedia of spirit John Rolfe